ID: 1168492360_1168492363

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1168492360 1168492363
Species Human (GRCh38) Human (GRCh38)
Location 19:56821542-56821564 19:56821560-56821582
Sequence CCCCAGCTGGACTCTAGGGGGCA GGGCAGATAAACACACCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153} {0: 1, 1: 0, 2: 0, 3: 4, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!