ID: 1168492418_1168492431

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1168492418 1168492431
Species Human (GRCh38) Human (GRCh38)
Location 19:56821908-56821930 19:56821937-56821959
Sequence CCCATAAAACCAGTGGCCCTACA CAGACCCAGGGCAGGGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111} {0: 1, 1: 3, 2: 6, 3: 113, 4: 948}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!