ID: 1168536426_1168536436

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1168536426 1168536436
Species Human (GRCh38) Human (GRCh38)
Location 19:57174112-57174134 19:57174141-57174163
Sequence CCACCTCAGGTGATCCACCCCCC TCCCAAAGTGTTGAGATTACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!