ID: 1168538520_1168538530

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1168538520 1168538530
Species Human (GRCh38) Human (GRCh38)
Location 19:57191699-57191721 19:57191730-57191752
Sequence CCCCGCGGTCTCCAGGGGCGGCG CTGGAACGCGGTTGCCACCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 116} {0: 1, 1: 1, 2: 0, 3: 2, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!