ID: 1168614466_1168614477

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1168614466 1168614477
Species Human (GRCh38) Human (GRCh38)
Location 19:57826693-57826715 19:57826737-57826759
Sequence CCGGTGTAGTGCACCACGCAGGT GCACTCCTCTCCTGGGGAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 41, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!