ID: 1168676215_1168676226

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1168676215 1168676226
Species Human (GRCh38) Human (GRCh38)
Location 19:58279585-58279607 19:58279607-58279629
Sequence CCACCGGGACCCCAGCACCGCGG GAGCCCCTGCCCTGGGGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223} {0: 1, 1: 0, 2: 3, 3: 89, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!