ID: 1168676215_1168676237

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1168676215 1168676237
Species Human (GRCh38) Human (GRCh38)
Location 19:58279585-58279607 19:58279633-58279655
Sequence CCACCGGGACCCCAGCACCGCGG AACCTCTTGGGGGCAATGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223} {0: 1, 1: 0, 2: 1, 3: 9, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!