ID: 1168685701_1168685720

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1168685701 1168685720
Species Human (GRCh38) Human (GRCh38)
Location 19:58347834-58347856 19:58347884-58347906
Sequence CCGCGCCACACGTGAGTGTCCCC CCCAGATTCGGGCCTGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!