ID: 1168687726_1168687732

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1168687726 1168687732
Species Human (GRCh38) Human (GRCh38)
Location 19:58358512-58358534 19:58358531-58358553
Sequence CCCAGGGGAGCCTCTTGCTCCTC CCTCTCCCTCCTCTGTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 217} {0: 1, 1: 0, 2: 6, 3: 83, 4: 656}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!