ID: 1168713402_1168713410

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1168713402 1168713410
Species Human (GRCh38) Human (GRCh38)
Location 19:58514071-58514093 19:58514108-58514130
Sequence CCGCCAGGTGGCGCTCCAGCAGC GACCTTGCCGCAGGCGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 322} {0: 1, 1: 1, 2: 1, 3: 20, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!