ID: 1168728745_1168728754

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1168728745 1168728754
Species Human (GRCh38) Human (GRCh38)
Location 19:58607242-58607264 19:58607294-58607316
Sequence CCTCCGCCGGCGCGCCGCCTTTG ACACCCGGAGAGCATCGCGACGG
Strand - +
Off-target summary No data {0: 4, 1: 9, 2: 36, 3: 13, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!