ID: 1168741239_1168741243

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1168741239 1168741243
Species Human (GRCh38) Human (GRCh38)
Location 20:193230-193252 20:193250-193272
Sequence CCTCTGGTGTTTGGGAAAGCAGA AGAGTATACGGGTTAGGTATAGG
Strand - +
Off-target summary {0: 1, 1: 59, 2: 30, 3: 41, 4: 325} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!