ID: 1168751054_1168751059

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1168751054 1168751059
Species Human (GRCh38) Human (GRCh38)
Location 20:281718-281740 20:281733-281755
Sequence CCTGTAATCCCAGCACTTTGGAA CTTTGGAAGAGCAAGGTGGAAGG
Strand - +
Off-target summary {0: 9594, 1: 299194, 2: 262940, 3: 149017, 4: 131705} {0: 1, 1: 5, 2: 189, 3: 3743, 4: 33869}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!