ID: 1168789022_1168789032

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1168789022 1168789032
Species Human (GRCh38) Human (GRCh38)
Location 20:563638-563660 20:563653-563675
Sequence CCCCTTCCCCCTAGAGCCACTGA GCCACTGAGGGGAGAGATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 265} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!