ID: 1168831165_1168831176

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1168831165 1168831176
Species Human (GRCh38) Human (GRCh38)
Location 20:845963-845985 20:846001-846023
Sequence CCTCTTGTGGGGCTGCATTTGCG CACTGTGAGTGAGGGGCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 88} {0: 1, 1: 0, 2: 1, 3: 22, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!