ID: 1168837224_1168837232

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1168837224 1168837232
Species Human (GRCh38) Human (GRCh38)
Location 20:885310-885332 20:885337-885359
Sequence CCGCTTCTCGAGCGCGCTGCGGG GGGGCGCACAGAGGTGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39} {0: 1, 1: 0, 2: 2, 3: 32, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!