ID: 1168878053_1168878059

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1168878053 1168878059
Species Human (GRCh38) Human (GRCh38)
Location 20:1184957-1184979 20:1184973-1184995
Sequence CCCACAGACGCGGGACCCGGAAG CCGGAAGGCCGAACCGGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 35} {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!