ID: 1168904589_1168904603

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1168904589 1168904603
Species Human (GRCh38) Human (GRCh38)
Location 20:1392983-1393005 20:1393023-1393045
Sequence CCACCTGCACTCCCATGGCGGCG GGGCGGCGCGACGGGCGGCGTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 1, 3: 6, 4: 113} {0: 1, 1: 1, 2: 5, 3: 77, 4: 855}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!