ID: 1168904591_1168904597

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1168904591 1168904597
Species Human (GRCh38) Human (GRCh38)
Location 20:1392986-1393008 20:1393002-1393024
Sequence CCTGCACTCCCATGGCGGCGGCG GGCGGCGGACGCTGAGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 0, 3: 11, 4: 87} {0: 1, 1: 0, 2: 1, 3: 28, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!