ID: 1168904591_1168904601

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1168904591 1168904601
Species Human (GRCh38) Human (GRCh38)
Location 20:1392986-1393008 20:1393015-1393037
Sequence CCTGCACTCCCATGGCGGCGGCG GAGCGGGCGGGCGGCGCGACGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 0, 3: 11, 4: 87} {0: 1, 1: 1, 2: 6, 3: 42, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!