ID: 1168904594_1168904606

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1168904594 1168904606
Species Human (GRCh38) Human (GRCh38)
Location 20:1392995-1393017 20:1393045-1393067
Sequence CCATGGCGGCGGCGGACGCTGAG GACCAACAGCGACCTGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 151} {0: 2, 1: 1, 2: 0, 3: 6, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!