ID: 1168909418_1168909422

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1168909418 1168909422
Species Human (GRCh38) Human (GRCh38)
Location 20:1435227-1435249 20:1435253-1435275
Sequence CCTCAGTTTGCATTGGCTTGCCC AATTTGCATGTAATTAAAAATGG
Strand - +
Off-target summary No data {0: 9, 1: 83, 2: 200, 3: 336, 4: 851}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!