ID: 1168984860_1168984862

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1168984860 1168984862
Species Human (GRCh38) Human (GRCh38)
Location 20:2039315-2039337 20:2039333-2039355
Sequence CCAGCAGACTCAACAACCGGCCC GGCCCAGCCATCTGTAAACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!