ID: 1168991873_1168991885

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1168991873 1168991885
Species Human (GRCh38) Human (GRCh38)
Location 20:2102625-2102647 20:2102655-2102677
Sequence CCTCCCCCGTTCAATCAGCGGCG CCGTCTTAAAGGGGCCGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30} {0: 1, 1: 0, 2: 0, 3: 3, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!