ID: 1169048765_1169048777

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1169048765 1169048777
Species Human (GRCh38) Human (GRCh38)
Location 20:2558955-2558977 20:2558982-2559004
Sequence CCCAGAACCGGGATGAAGATCGC CCGCGCGGGGGAGTGGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 30} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!