ID: 1169057412_1169057414

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1169057412 1169057414
Species Human (GRCh38) Human (GRCh38)
Location 20:2635004-2635026 20:2635034-2635056
Sequence CCAAAGCTGGAGCAGCTGAGCTT ATGGAGAAAAACTACTAATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 286} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!