ID: 1169060513_1169060518

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1169060513 1169060518
Species Human (GRCh38) Human (GRCh38)
Location 20:2657477-2657499 20:2657516-2657538
Sequence CCTCAACCTGGGGTAGTGTAAAT ATCAGACGTGTGTCCGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62} {0: 1, 1: 0, 2: 1, 3: 1, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!