ID: 1169074366_1169074381

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1169074366 1169074381
Species Human (GRCh38) Human (GRCh38)
Location 20:2752137-2752159 20:2752176-2752198
Sequence CCCCGCGCACCCGGGCCGCTCGC CACCCACACCCCGCCGTCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 222} {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!