ID: 1169083025_1169083030

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1169083025 1169083030
Species Human (GRCh38) Human (GRCh38)
Location 20:2809068-2809090 20:2809081-2809103
Sequence CCCCATAACGCCTAGCGGTTACC AGCGGTTACCCCGAGTCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 6} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!