ID: 1169096857_1169096861

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1169096857 1169096861
Species Human (GRCh38) Human (GRCh38)
Location 20:2908449-2908471 20:2908488-2908510
Sequence CCACTGTGGGACTTGAGTGTGCA CGGTTGATCCACAGATACCAAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 5, 3: 19, 4: 178} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!