ID: 1169108536_1169108542

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1169108536 1169108542
Species Human (GRCh38) Human (GRCh38)
Location 20:3018109-3018131 20:3018150-3018172
Sequence CCTGTATTTGGTAGTCAAACAAC AGCCTGAAAGAGACTGACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!