ID: 1169135514_1169135523

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1169135514 1169135523
Species Human (GRCh38) Human (GRCh38)
Location 20:3194899-3194921 20:3194937-3194959
Sequence CCCCTAGCAAGCCCACAGGGTTC AAGTACCACCTGCTCACTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89} {0: 1, 1: 0, 2: 1, 3: 17, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!