ID: 1169145974_1169145977

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1169145974 1169145977
Species Human (GRCh38) Human (GRCh38)
Location 20:3252565-3252587 20:3252601-3252623
Sequence CCTTCCTCTAGGGCTTCAGCTCA ACTCCTGCTGTTCCAGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 245} {0: 1, 1: 1, 2: 3, 3: 43, 4: 564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!