ID: 1169171850_1169171860

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1169171850 1169171860
Species Human (GRCh38) Human (GRCh38)
Location 20:3471455-3471477 20:3471484-3471506
Sequence CCAGTGCGTCTGCCCCGCCGGCT GCGAGCAATGCCAGCACTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 130} {0: 1, 1: 0, 2: 3, 3: 32, 4: 592}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!