ID: 1169198748_1169198758

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1169198748 1169198758
Species Human (GRCh38) Human (GRCh38)
Location 20:3697434-3697456 20:3697470-3697492
Sequence CCCCTGGGGTGCCCACAGGGTTG GCTAGCTCACAGGGCAGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 192} {0: 1, 1: 0, 2: 0, 3: 15, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!