ID: 1169229052_1169229065

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1169229052 1169229065
Species Human (GRCh38) Human (GRCh38)
Location 20:3874894-3874916 20:3874931-3874953
Sequence CCTACACCCCCCTAGGGTCAGTG GGGTGAGCCCAATGGCTAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 115} {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!