ID: 1169229058_1169229064

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1169229058 1169229064
Species Human (GRCh38) Human (GRCh38)
Location 20:3874904-3874926 20:3874930-3874952
Sequence CCTAGGGTCAGTGGCGCCTGCCT AGGGTGAGCCCAATGGCTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 525} {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!