ID: 1169246719_1169246730

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1169246719 1169246730
Species Human (GRCh38) Human (GRCh38)
Location 20:4031872-4031894 20:4031887-4031909
Sequence CCCTCCCCCGCCCCCCTCTGATG CTCTGATGCCGAGCCAAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 60, 4: 647} {0: 142, 1: 549, 2: 481, 3: 358, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!