ID: 1169246729_1169246734

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1169246729 1169246734
Species Human (GRCh38) Human (GRCh38)
Location 20:4031886-4031908 20:4031908-4031930
Sequence CCTCTGATGCCGAGCCAAAGCTG GGACGGTACTGCTGCCATCTCGG
Strand - +
Off-target summary No data {0: 125, 1: 829, 2: 365, 3: 139, 4: 530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!