ID: 1169252876_1169252884

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1169252876 1169252884
Species Human (GRCh38) Human (GRCh38)
Location 20:4073583-4073605 20:4073606-4073628
Sequence CCTTTCCTATTTCTATGAGCTGT TCTTGGGGATGGAGGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 550} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!