ID: 1169278478_1169278485

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1169278478 1169278485
Species Human (GRCh38) Human (GRCh38)
Location 20:4248839-4248861 20:4248868-4248890
Sequence CCCTCCGAGGGGGCCGCGCCGCC GCCCCCGCCGCCGCCCGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 137} {0: 1, 1: 4, 2: 31, 3: 268, 4: 1011}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!