ID: 1169316568_1169316575

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1169316568 1169316575
Species Human (GRCh38) Human (GRCh38)
Location 20:4595953-4595975 20:4595968-4595990
Sequence CCACCCACCTTGGCCTTACAAAG TTACAAAGTGCTGGGATTACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!