ID: 1169339268_1169339274

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1169339268 1169339274
Species Human (GRCh38) Human (GRCh38)
Location 20:4783787-4783809 20:4783821-4783843
Sequence CCCTCTTCCCTCTCTAAACACAG GCTGCTCCCTGGCACTTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 38, 4: 435} {0: 1, 1: 0, 2: 1, 3: 15, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!