ID: 1169344992_1169345010

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1169344992 1169345010
Species Human (GRCh38) Human (GRCh38)
Location 20:4822784-4822806 20:4822829-4822851
Sequence CCGCCTCCCCGCGCCGGGGACTG CCTAGAAGACGGCGGCGGACTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 42, 4: 308} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!