ID: 1169382363_1169382374

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1169382363 1169382374
Species Human (GRCh38) Human (GRCh38)
Location 20:5119442-5119464 20:5119482-5119504
Sequence CCCCACTGCGTGGCAGGCCAATG CACGCCAGCCAATGAGGGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 82} {0: 1, 1: 0, 2: 0, 3: 2, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!