ID: 1169383262_1169383267

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1169383262 1169383267
Species Human (GRCh38) Human (GRCh38)
Location 20:5127000-5127022 20:5127024-5127046
Sequence CCGGCCGTGGGAGTCCGCGCGTG CCGCGCCGAGCTGCCTGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81} {0: 1, 1: 0, 2: 0, 3: 6, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!