ID: 1169415904_1169415907

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1169415904 1169415907
Species Human (GRCh38) Human (GRCh38)
Location 20:5416029-5416051 20:5416044-5416066
Sequence CCTCCAAGGATCTGGGCTGCAAC GCTGCAACATCAATTCTCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 27, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!