ID: 1169416802_1169416807

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1169416802 1169416807
Species Human (GRCh38) Human (GRCh38)
Location 20:5424138-5424160 20:5424160-5424182
Sequence CCTTTTGCCAAGTAAGATAACAT TACTCACAGGTTCCAGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 31, 2: 230, 3: 724, 4: 1679} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!