ID: 1169426165_1169426172

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1169426165 1169426172
Species Human (GRCh38) Human (GRCh38)
Location 20:5498892-5498914 20:5498931-5498953
Sequence CCATGTGCACTGGGTGGGGCTTT GAGAGTTCTTCTTAGGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 203} {0: 1, 1: 0, 2: 1, 3: 9, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!