ID: 1169426478_1169426484

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1169426478 1169426484
Species Human (GRCh38) Human (GRCh38)
Location 20:5501146-5501168 20:5501174-5501196
Sequence CCACGCAGCAGTCACGTGAGGTC TCTGGGAAGGTCCTCCCTGATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 21, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!